You Have Beautiful Genes
Genetic
DNA is made of very long strings of just four kinds of molecules called
base pairs. These base pairs are usually represented using the
first letter of their chemical names, ACGT, making genetic information
look seemingly random and unintelligible, like this.
ATCCCTTAGGTATACCTTTTTATTAGCGTAGCCTTAGCCCGTATAGAAGGGCCTCTAACTTTTCAAATTTT
However, the DNA of living organisms is anything but random and often
forms long arrays of complex and very beautiful patterns. This becomes
apparent when the strings are represented by brightly colored spheres,
as in the images below. Each image shows a small stretch of DNA about
300 base pairs long, built from many smaller pieces as they are assembled by a computer program.
|