R Allan Barker          science | technology | history | philosophy + curiosity
Last update December 5, 2013 Contact me


You Have Beautiful Genes

Genetic DNA is made of very long strings of just four kinds of molecules called base pairs. These base pairs are usually represented using the first letter of their chemical names, ACGT, making genetic information look seemingly random and unintelligible, like this.

ATCCCTTAGGTATACCTTTTTATTAGCGTAGCCTTAGCCCGTATAGAAGGGCCTCTAACTTTTCAAATTTT

However, the DNA of living organisms is anything but random and often forms long arrays of complex and very beautiful patterns. This becomes apparent when the strings are represented by brightly colored spheres, as in the images below. Each image shows a small stretch of DNA about 300 base pairs long, built from many smaller pieces as they are assembled by a computer program.

    From Human Chromosome 14

























    repeated


    repeated